volanesorsen

Ligand id: 8681

Name: volanesorsen

Classification
Compound class Synthetic organic
International Nonproprietary Names
INN number INN
10166 volanesorsen
Synonyms
APOC-III antisense inhibitor | ISIS 304801 | ISIS-APOCIIIRx
Database Links
Search PubMed clinical trials volanesorsen
Search PubMed titles volanesorsen
Search PubMed titles/abstracts volanesorsen
Comments
Volanesorsen is an antisense oligonucleotide (ASO) designed to reduce levels of apolipoprotein C-III (APOC3) in patients with elevated blood triglyceride levels [2]. Reducing triglycerides via APOC3 could be beneficial in patients with inherited hypertriglyceridemia (e.g. those with familial chylomicronemia syndrome, FCS) [1]. The role of APOC3 in hypertriglyceridemia and the effects APOC3 ASO use are reviewed in [3].
We have been unable to ascertain the precise chemical structure of volanesorsen, but believe it is based on the core sequence agcttcttgtccagctttat, provided in patent US20140128453 as 'Artificial SequenceSynthetic oligonucleotide 3' [4].