GtoPdb is requesting financial support from commercial users. Please see our sustainability page for more information.

casimersen   Click here for help

GtoPdb Ligand ID: 11444

Synonyms: Amondys 45® | SRP-4045 | SRP4045
Approved drug
casimersen is an approved drug (FDA (2021))
Compound class: Nucleic acid
Comment: Casimersen is an antisense phosphorodiamidate morpholino oligomer (ASO) that is approved to treat certain patients with Duchenne muscular dystrophy (DMD). It promotes functional dystrophin synthesis in patients who have dystrophin gene variants that are amenable to exon 45 skipping, that is sufficient to restore some muscle function and slow disease progression.
We have been unable to resolve the full sequence provided in the INN record for casimersen to a SMILES or full IUPAC descriptor.
Nucleic Acid Sequence Click here for help
CAATGCCATCCTGGAGTTCCTG