GtoPdb is requesting financial support from commercial users. Please see our sustainability page for more information.

golodirsen   Click here for help

GtoPdb Ligand ID: 13605

Synonyms: SRP-4053 | SRP4053 | VYONDYS 53®
Approved drug
golodirsen is an approved drug (FDA (2019))
Compound class: Nucleic acid
Comment: Golodirsen (SRP-4053) is an antisense RNA oligonucleotide that uses the phosphorodiamidate morpholino oligomer (PMO) chemistry [2]. It was designed to induce exon 53 skipping in the dystrophin gene as a mechanism to increase expression of functional dystrophin protein in the muscle fibers of appropriately selected Duchenne muscular dystrophy patients [1].

Full sequence as provided in the agent's INN record is: all-P-ambo-[2′,3′-Azanediyl-P-(dimethylamino)-P,2′,3′-trideoxy-2′,3′-seco](2′-N→5′)(G-T-T-G-C-C-T-C-C-G-G-T-T-C-T-G-A-A-G-G-T-G-T-T-C) 5′-{P-[4-({2-[2-(2-hydroxyethoxy)ethoxy]ethoxy}carbonyl)piperazin-1-yl]-N,N-dimethylphosphonamidate}, but we have been unable to resolve this to a SMILES or HELM notation.
Nucleic Acid Sequence Click here for help
GTTGCCTCCGGTTCTGAAGGTGTTC