remlarsen   Click here for help

GtoPdb Ligand ID: 13636

Synonyms: MRG-201 | MRG201
Compound class: Nucleic acid
Comment: Remlarsen (MRG-201) is a miRNA class ligand that is a synthetic mimic of microRNA-29 (miR-29b). It is proposed as an anti-fibrotic agent.
We have been unable to locate a full chemical SMILES for the ligand, or its HELM notation.
Nucleic Acid Sequence Click here for help
(3'-5')AACACUGUUUACAAAUGGUCCUA-(R)
(5'-3')UUUUGUGACUAAAGUUUACCACGAU