zodasiran   Click here for help

GtoPdb Ligand ID: 13640

Synonyms: ARO-ANG3
Compound class: Nucleic acid
Comment: Zodasiran (ARO-ANG3) is a RNA interference (RNAi, or siRNA) class novel therapeutic. The molecule includes bases that are modified to improve stability, and is congugated (at R1 position) with N-acetylgalactosamine (GalNAc), which binds to an asialoglycoprotein receptor expressed on hepatocyte membranes to promote delivery of the drug to the liver [1]. Once bound, the siRNA is internalised in lysosomes and is subsequently released into the cytosol. Zodasiran is designed to reduce synthesis of angiopoietin-like 3 (ANGPTL3), an hepatic peptide that regulates lipid and lipoprotein metabolism, including triglyceride-rich lipoproteins and cholesterol that are associated with cardiovascular disease risk.
We have been unable to locate a full chemical SMILES for the ligand, or its HELM notation.
Nucleic Acid Sequence Click here for help
(3'-5')R1-GCUCAACAUAUUUGAUCAGUA
(5'-3')CGAGUUGUAUAAACUAGUCAU