GtoPdb is requesting financial support from commercial users. Please see our sustainability page for more information.

lepodisiran   Click here for help

GtoPdb Ligand ID: 13708

Synonyms: LY-3819469 | LY3819469
Compound class: Nucleic acid
Comment: Lepodisiran (LY3819469) is an apolipoprotein A synthesis reducer. It is a GalNac-conjugated short interfering RNA (siRNA) that was designed to treat atherosclerotic cardiovascular disease in patients with elevated lipoprotein A [1-2].
Nucleic Acid Sequence Click here for help
(3'-5')UUGCCAAGCUUGGUCAUCUAGCAGCCGAAAGGCUGC
(5'-3')GGAACGGUUCGAACCAGUAGAU