olpasiran   Click here for help

GtoPdb Ligand ID: 13709

Synonyms: AMG-890 | AMG890
Compound class: Nucleic acid
Comment: Olpasiran (AMG890) is an apolipoprotein A synthesis reducer. It is a GalNac-conjugated short interfering RNA (siRNA) that was designed to treat atherosclerotic cardiovascular disease in patients with elevated lipoprotein A [1-2].
We have been unable to locate a full chemical SMILES for the drug, or its HELM notation. We provide the basic nucleic acid structure for the molecule here. Full specifications for all modifications are available from its INN record.
Nucleic Acid Sequence Click here for help
(3'-5')CAGCCCCUUAUUGUUAUACGA
(5'-3')GUCGGGGAAUAACAAUAUGCU