GtoPdb is requesting financial support from commercial users. Please see our sustainability page for more information.

lonvoguran   Click here for help

GtoPdb Ligand ID: 13712

Synonyms: NTLA-2002 | NTLA2002
Compound class: Nucleic acid
Comment: Lonvoguran (NTLA-2002) is a synthetic single guide RNA CRISPR/Cas drug that targets the human KLKB1 gene and knocks out plasma kallikrein expression [1-3]. The guide RNA (G012267) is encapsulated within lipid nanoparticles for effective delivery. A single dose of lonvoguran is proposed to provide lifelong control of angioedema attacks, for patients with uncontrolled plasma kallikrein production due to mutations in the SERPING1 gene.
We have been unable to locate a full chemical SMILES for the drug, or its HELM notation. We provide the basic nucleic acid structure for the molecule here. Full specifications for all modifications are available from its INN record.
Nucleic Acid Sequence Click here for help
(3'-5')GGAUUGCGUAUGGGACACAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU