raltegravir [Ligand Id: 11571] activity data from GtoPdb and ChEMBL

Click here for a description of the charts and data table

Please tell us if you are using this feature and what you think!

ChEMBL ligand: CHEMBL254316 (Isentress, MK-0518, Raltegravir)
  • CCR1/C-C chemokine receptor type 1 in Human [ChEMBL: CHEMBL2413] [GtoPdb: 58] [UniProtKB: P32246]
There should be some charts here, you may need to enable JavaScript!
There should be some charts here, you may need to enable JavaScript!
There should be some charts here, you may need to enable JavaScript!
  • Human immunodeficiency virus type 1 integrase in Human immunodeficiency virus 1 [ChEMBL: CHEMBL3471] [UniProtKB: Q7ZJM1]
There should be some charts here, you may need to enable JavaScript!
  • Human immunodeficiency virus type 1 reverse transcriptase in Human immunodeficiency virus 1 [ChEMBL: CHEMBL247] [UniProtKB: Q72547]
There should be some charts here, you may need to enable JavaScript!
  • Kv7.1/Voltage-gated potassium channel, IKs; KCNQ1(Kv7.1)/KCNE1(MinK) in Human [ChEMBL: CHEMBL2221347] [GtoPdb: 560] [UniProtKB: P15382P51787]
There should be some charts here, you may need to enable JavaScript!
DB Assay description Assay Type Standard value Standard parameter Original value Original units Original parameter Reference
CCR1/C-C chemokine receptor type 1 in Human (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL2413] [GtoPdb: 58] [UniProtKB: P32246]
ChEMBL Binding affinity to CCR1 B 8.3 pKi 5 nM Ki J Med Chem (2012) 55: 9363-9392 [PMID:22931505]
DNA polymerase beta in Human (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL2392] [GtoPdb: 3231] [UniProtKB: P06746]
ChEMBL Inhibition of human DNA polymerase beta B 4.3 pIC50 >50000 nM IC50 J Med Chem (2008) 51: 5843-5855 [PMID:18763751]
Kv11.1/HERG in Human (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL240] [GtoPdb: 572] [UniProtKB: Q12809]
ChEMBL Binding affinity to human ERG B 4.3 pIC50 >50000 nM IC50 J Med Chem (2008) 51: 5843-5855 [PMID:18763751]
Human immunodeficiency virus type 1 integrase in Human immunodeficiency virus 1 (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL3471] [UniProtKB: Q7ZJM1]
ChEMBL Inhibition of subunit exchanging activity of His and Flag-tagged HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells after 2.5 hrs by HTRF assay B 4 pIC50 >100000 nM IC50 Eur J Med Chem (2019) 182: 111617-111617 [PMID:31442684]
ChEMBL Inhibition of HIV1 integrase 3'-processing activity by gel-based assays B 4.89 pIC50 12800 nM IC50 J Med Chem (2014) 57: 3223-3234 [PMID:24684270]
ChEMBL Inhibition of HIV-1 integrase assessed as inhibition of 3'-processing activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in presence of Mg2+ B 4.89 pIC50 12800 nM IC50 J Med Chem (2015) 58: 4610-4623 [PMID:25961960]
ChEMBL Inhibition of HIV1 recombinant integrase 3'-processing activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor magnesium B 5.35 pIC50 >4500 nM IC50 Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL Inhibition of HIV1 recombinant integrase 3'-processing activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor manganese B 5.35 pIC50 >4500 nM IC50 Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL Inhibition of HIV-1 integrase after 1 hr by strand transfer activity assay B 5.74 pIC50 1800 nM IC50 Bioorg Med Chem (2015) 23: 735-741 [PMID:25618597]
ChEMBL Inhibition of recombinant HIV1 integrase strand transfer activity using biotin-labeled double-stranded HIV1 LTR U5 donor DNA substrate pretreated for 5 mins followed by substrate addition and measured after 30 mins by ELISA B 5.96 pIC50 1100 nM IC50 Bioorg Med Chem (2019) 27: 3595-3604 [PMID:31285097]
ChEMBL Inhibition of Human immunodeficiency virus 1 integrase-mediated strand transfer activity after 1 hr B 6.05 pIC50 900 nM IC50 Bioorg Med Chem (2012) 20: 177-182 [PMID:22154762]
ChEMBL Inhibition of 3'-processing activity of HIV1 integrase using 32P-5'-TGTGGAAAATCTCTAGCAGT-3' and 5'-ACTGCTAGAGATTTTCCACA-3' as substrate after 1 hr by ELISA B 6.05 pIC50 900 nM IC50 ACS Med Chem Lett (2013) 4: 606-611 [PMID:24900718]
ChEMBL Inhibition of HIV1 integrase 3'-end processing activity B 6.05 pIC50 900 nM IC50 J Med Chem (2008) 51: 7717-7730 [PMID:19053754]
ChEMBL Inhibition of HIV integrase strand transfer activity using 5'-biotin/3'-Cy5-labeled DNA substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by HTS assay B 6.19 pIC50 650 nM IC50 Eur J Med Chem (2018) 156: 652-665 [PMID:30031976]
ChEMBL Inhibition of HIV1 integrase strand transfer activity using 5'-biotinylated oligonucleotide as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins B 6.19 pIC50 650 nM IC50 Eur J Med Chem (2019) 166: 390-399 [PMID:30739822]
ChEMBL Inhibition of HIV1 recombinant integrase expressed in Escherichia coli using [32P]-labeled oligonucleotide as substrate after 60 mins by strand transfer activity assay B 6.19 pIC50 650 nM IC50 J Med Chem (2016) 59: 6136-6148 [PMID:27283261]
ChEMBL Inhibition of HIV1 integrase pre-incubated for 10 mins before DNA substrate addition and measured after 30 mins B 6.19 pIC50 650 nM IC50 Eur J Med Chem (2017) 141: 149-161 [PMID:29031062]
ChEMBL Inhibition of recombinant HIV1 integrase strand transfer activity using biotin-labeled double-stranded HIV-1 LTR U5 donor DNA substrate pretreated for 5 mins followed by substrate addition and measured after 30 mins by ELISA B 6.7 pIC50 200 nM IC50 Eur J Med Chem (2018) 155: 714-724 [PMID:29940462]
ChEMBL Inhibition of HIV1 integrase B 6.92 pIC50 120 nM IC50 Bioorg Med Chem Lett (2014) 24: 302-307 [PMID:24291042]
ChEMBL Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in presence of Mg2+ B 7.06 pIC50 87 nM IC50 J Med Chem (2015) 58: 4610-4623 [PMID:25961960]
ChEMBL Inhibition of HIV1 integrase strand transfer activity by gel-based assay B 7.06 pIC50 87 nM IC50 J Med Chem (2014) 57: 3223-3234 [PMID:24684270]
ChEMBL Inhibition of HIV1 integrase using labelled oligonucleotide substrate by ELISA B 7.1 pIC50 80 nM IC50 Bioorg Med Chem Lett (2009) 19: 3615-3618 [PMID:19447621]
ChEMBL Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor manganese B 7.13 pIC50 74 nM IC50 Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL Inhibition of strand transfer activity of HIV1 integrase expressed in Escherichia coli using DNA complexes containing 32P-labeled INT1ST and and non-labeled INT2 B 7.15 pIC50 71 nM IC50 Bioorg Med Chem (2019) 27: 3836-3845 [PMID:31324562]
ChEMBL Inhibition of HIV1 integrase 3'-processing activity using labelled oligonucleotide substrate by ELISA B 7.17 pIC50 67 nM IC50 Bioorg Med Chem Lett (2009) 19: 3615-3618 [PMID:19447621]
ChEMBL Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor magnesium B 7.17 pIC50 67 nM IC50 Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 30 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis B 7.17 pIC50 67 nM IC50 Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL Inhibition of LEDGF/p75-dependent full length HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells preincubated for 1 hr further incubated for 90 mins with biotin-labeled donor DNA and target DNA by HTRF assay B 7.24 pIC50 58 nM IC50 Eur J Med Chem (2019) 182: 111617-111617 [PMID:31442684]
ChEMBL Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'-CGACGCGTGGTAGGCCTGT-Biotin3'/5'-Cy5-ATGTGGAAAATCTCTAGCAGT-3' annealed with 5'-Cy5-TGAGCTCGAGATTTTCCACAT-3' as donar/acceptor DNA substrate preincubated for 1 hr followed by DNA and LEDGF/p75 addition measured after 90 mins by HTRF assay B 7.28 pIC50 53 nM IC50 Bioorg Med Chem Lett (2015) 25: 3013-3016 [PMID:26048795]
ChEMBL Inhibition of HIV-1 integrase G140S mutant strand transfer activity preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by microplate reader analysis B 7.3 pIC50 50 nM IC50 ACS Med Chem Lett (2015) 6: 1065-1070 [PMID:26487913]
ChEMBL Inhibition of HIV1 integrase strand transfer activity B 7.47 pIC50 34 nM IC50 Antimicrob Agents Chemother (2009) 53: 1194-1203 [PMID:19104010]
ChEMBL Inhibition of wild type recombinant HIV1 His6-tagged integrase expressed in Escherichia coli BL21 using 18 nucleotide 3'-biotin labeled DNA acceptor as substrate preincubated for 1 hr followed by substrate addition and further incubated for 90 mins in presence of recombinant LEDGF/p75 by HTRF assay B 7.57 pIC50 27 nM IC50 ACS Med Chem Lett (2020) 11: 766-772 [PMID:32435383]
ChEMBL Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as DNA substrate incubated for 2 hrs by densitometric analysis B 7.72 pIC50 19 nM IC50 J Med Chem (2021) 64: 8579-8598 [PMID:34106711]
ChEMBL Displacement of 20 nM [3H]GSK304649 from Human immunodeficiency virus 1 integrase by scintillation proximity assay B 7.8 pIC50 16 nM IC50 Antimicrob Agents Chemother (2008) 52: 901-908 [PMID:18160521]
ChEMBL Inhibition of HIV-1 integrase G140S/Q148K double mutant B 7.82 pIC50 15 nM IC50 J Med Chem (2023) 66: 13874-13887 [PMID:37827528]
ChEMBL Inhibition of recombinant HIV-1 integrase strand transfer activity B 7.82 pIC50 15 nM IC50 Bioorg Med Chem Lett (2009) 19: 4617-4621 [PMID:19616948]
ChEMBL Inhibition of HIV1 recombinant integrase strand transfer activity B 7.82 pIC50 15 nM IC50 J Med Chem (2008) 51: 5843-5855 [PMID:18763751]
ChEMBL Inhibition of recombinant HIV-1 integrase strand transfer activity by enzymatic assay B 7.82 pIC50 15 nM IC50 J Med Chem (2022) 65: 5830-5849 [PMID:35377638]
ChEMBL Inhibition of HIV-1 integrase strand transfer activity B 7.82 pIC50 15 nM IC50 J Med Chem (2023) 66: 13874-13887 [PMID:37827528]
ChEMBL Inhibition of recombinant HIV-1 integrase stand transfer activity expressed in Escherichia coli BL21(DE3) cells using 32P-labeled DNA substrate after 1 hr by densitometric analysis B 7.89 pIC50 13 nM IC50 Eur J Med Chem (2015) 104: 127-138 [PMID:26451771]
ChEMBL Inhibition of HIV1 integrase overall inhibition using 5'-digoxigenin-labeled 5'-GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT-3' as substrate after 1 hr by ELISA B 8 pIC50 10 nM IC50 ACS Med Chem Lett (2013) 4: 606-611 [PMID:24900718]
ChEMBL Inhibition of HIV-1 overall integrase activity using 5'-digoxigenin-labeled GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT-3' as substrate after 1 hr by ELISA B 8 pIC50 10 nM IC50 J Med Chem (2014) 57: 4640-4660 [PMID:24793360]
ChEMBL Inhibition of HIV-1 integrase after 1 hr by ELISA B 8.05 pIC50 9 nM IC50 Eur J Med Chem (2011) 46: 756-764 [PMID:21227550]
ChEMBL Inhibition of HIV1 integrase B 8.05 pIC50 9 nM IC50 Bioorg Med Chem (2010) 18: 5510-5518 [PMID:20630765]
ChEMBL Inhibition of Human immunodeficiency virus 1 integrase B 8.05 pIC50 9 nM IC50 Antimicrob Agents Chemother (2008) 52: 2861-2869 [PMID:18541726]
ChEMBL Inhibition of HIV1 integrase B 8.05 pIC50 9 nM IC50 J Med Chem (2008) 51: 7717-7730 [PMID:19053754]
ChEMBL Inhibition of HIV1 integrase B 8.05 pIC50 9 nM IC50 Bioorg Med Chem Lett (2008) 18: 2891-2895 [PMID:18417342]
ChEMBL Inhibition of HIV1 integrase strand transfer B 8.15 pIC50 7 nM IC50 Bioorg Med Chem (2010) 18: 5510-5518 [PMID:20630765]
ChEMBL Inhibition of HIV-1 integrase strand transfer activity preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by microplate reader analysis B 8.15 pIC50 7 nM IC50 ACS Med Chem Lett (2015) 6: 1065-1070 [PMID:26487913]
ChEMBL Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by electrochemiluminescent plate-based assay B 8.15 pIC50 7 nM IC50 J Med Chem (2013) 56: 8588-8598 [PMID:24124919]
ChEMBL Inhibition of HIV1 integrase strand transfer activity B 8.15 pIC50 7 nM IC50 J Med Chem (2008) 51: 7717-7730 [PMID:19053754]
ChEMBL Inhibition of HIV1 integrase strand transfer activity B 8.15 pIC50 7 nM IC50 Bioorg Med Chem Lett (2008) 18: 2891-2895 [PMID:18417342]
ChEMBL Inhibition of strand transfer activity of HIV1 integrase using pre-cleaved oligonucleotide as substrate after 1 hr by ELISA B 8.15 pIC50 7 nM IC50 ACS Med Chem Lett (2013) 4: 606-611 [PMID:24900718]
ChEMBL Inhibition of HIV-1 integrase strand transfer activity by gel-based assay B 8.15 pIC50 7 nM IC50 J Med Chem (2015) 58: 1915-1928 [PMID:25629256]
ChEMBL Inhibition of Human immunodeficiency virus 1 integrase strand transfer activity B 8.17 pIC50 6.8 nM IC50 Antimicrob Agents Chemother (2008) 52: 2861-2869 [PMID:18541726]
ChEMBL Inhibition of HIV1 recombinant integrase 3'-processing and strand transfer activity using 21-mer U5B/U5A duplex oligonucleotides after 1 hr B 8.3 pIC50 5 nM IC50 Bioorg Med Chem (2011) 19: 5000-5005 [PMID:21767953]
ChEMBL Inhibition of Human immunodeficiency virus 1 integrase by strand transfer scintillation proximity assay B 8.48 pIC50 3.3 nM IC50 Antimicrob Agents Chemother (2008) 52: 901-908 [PMID:18160521]
ChEMBL Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'-CGACGCGTGGTAGGCCTGT-Biotin3'/5'-Cy5-ATGTGGAAAATCTCTAGCAGT-3' annealed with 5'-Cy5-TGAGCTCGAGATTTTCCACAT-3' as donar/acceptor DNA substrate preincubated for 1 hr followed by DNA and LEDGF/p75 addition measured after 90 mins by HTRF assay in presence of 300 mM sucrose B 8.62 pIC50 2.4 nM IC50 Bioorg Med Chem Lett (2015) 25: 3013-3016 [PMID:26048795]
ChEMBL Inhibition of HIV integrase strand transfer activity B 8.7 pIC50 2 nM IC50 Bioorg Med Chem (2019) 27: 3836-3845 [PMID:31324562]
Human immunodeficiency virus type 1 reverse transcriptase in Human immunodeficiency virus 1 (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL247] [UniProtKB: Q72547]
ChEMBL Inhibition of HIV1 RNase H function of recombinant reverse transcriptase using an 18-nt 3'-fluorescein-labeled RNA annealed to complementary 18-nt 5'-dabsyl-labeled DNA as substrate after 10 mins by fluorescence spectrometer analysis B 4 pIC50 >100000 nM IC50 J Med Chem (2014) 57: 3223-3234 [PMID:24684270]
ChEMBL Inhibition of RNase H function of HIV1 reverse transcriptase using DNA/RNA hybrid as substrate by fluorescence spectrometer analysis B 4 pIC50 >100000 nM IC50 J Med Chem (2015) 58: 4610-4623 [PMID:25961960]
ChEMBL Inhibition of RNH activity of recombinant HIV1 reverse transcriptase RNase H assessed as reduction in internal cleavage of RNA strand using RNA/DNA duplex substrate HTS-1 B 5 pIC50 >10000 nM IC50 Eur J Med Chem (2017) 141: 149-161 [PMID:29031062]
ChEMBL Inhibition of HIV1 reverse transcriptase RNaseH activity using 3'-fluorescein/5'-Dabcyl labeled HTS-1 substrate B 5 pIC50 >10000 nM IC50 Eur J Med Chem (2018) 156: 652-665 [PMID:30031976]
ChEMBL Inhibition of HIV1 reverse transcriptase RNase H expressed in Escherichia coli JM109 using RNA/DNA duplex substrate HTS-1 B 5 pIC50 >10000 nM IC50 Eur J Med Chem (2019) 166: 390-399 [PMID:30739822]
ChEMBL Inhibition of RNase H activity of full length HIV1 reverse transcriptase using RNA-DNA duplex HTS-1 substrate B 5 pIC50 >10000 nM IC50 J Med Chem (2016) 59: 6136-6148 [PMID:27283261]
Kv7.1/Voltage-gated potassium channel, IKs; KCNQ1(Kv7.1)/KCNE1(MinK) in Human (target type: PROTEIN COMPLEX) [ChEMBL: CHEMBL2221347] [GtoPdb: 560] [UniProtKB: P15382P51787]
ChEMBL Inhibition of slow delayed inward rectifying potassium current (Iks) in Chinese Hamster Ovary (CHO) cells expressing hKvLQT1/hminK measured using IonWorks Quattro automated patch clamp platform F 4.6 pIC50 25118.86 nM IC50 J Pharmacol Toxicol Methods (2014) 70: 246-254 [PMID:25087753]

ChEMBL data shown on this page come from version 35:

Zdrazil B, Felix E, Hunter F, Manners EJ, Blackshaw J, Corbett S, de Veij M, Ioannidis H, Lopez DM, Mosquera JF, Magarinos MP, Bosc N, Arcila R, Kizilören T, Gaulton A, Bento AP, Adasme MF, Monecke P, Landrum GA, Leach AR. (2024). The ChEMBL Database in 2023: a drug discovery platform spanning multiple bioactivity data types and time periods. Nucleic Acids Res., 52(D1). DOI: 10.1093/nar/gkad1004. [EPMCID:10767899] [PMID:37933841]
Davies M, Nowotka M, Papadatos G, Dedman N, Gaulton A, Atkinson F, Bellis L, Overington JP. (2015) 'ChEMBL web services: streamlining access to drug discovery data and utilities.' Nucleic Acids Res., 43(W1). DOI: 10.1093/nar/gkv352. [EPMCID:25883136]