ChEMBL ligand: CHEMBL254316 (Isentress, MK-0518, Raltegravir)
CCR1/C-C chemokine receptor type 1 in Human [ChEMBL: CHEMBL2413] [GtoPdb: 58] [UniProtKB: P32246] There should be some charts here, you may need to enable JavaScript!
DNA polymerase beta in Human [ChEMBL: CHEMBL2392] [GtoPdb: 3231] [UniProtKB: P06746] There should be some charts here, you may need to enable JavaScript!
Kv11.1/HERG in Human [ChEMBL: CHEMBL240] [GtoPdb: 572] [UniProtKB: Q12809] There should be some charts here, you may need to enable JavaScript!
Human immunodeficiency virus type 1 integrase in Human immunodeficiency virus 1 [ChEMBL: CHEMBL3471] [UniProtKB: Q7ZJM1] There should be some charts here, you may need to enable JavaScript!
Human immunodeficiency virus type 1 reverse transcriptase in Human immunodeficiency virus 1 [ChEMBL: CHEMBL247] [UniProtKB: Q72547] There should be some charts here, you may need to enable JavaScript!
Kv7.1/Voltage-gated potassium channel, IKs; KCNQ1(Kv7.1)/KCNE1(MinK) in Human [ChEMBL: CHEMBL2221347] [GtoPdb: 560] [UniProtKB: P15382, P51787] There should be some charts here, you may need to enable JavaScript!

DB	Assay description	Assay Type	Standard value	Standard parameter	Original value	Original units	Original parameter	Reference
CCR1/C-C chemokine receptor type 1 in Human (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL2413] [GtoPdb: 58] [UniProtKB: P32246]
ChEMBL	Binding affinity to CCR1	B	8.3	pKi	5	nM	Ki	J Med Chem (2012) 55: 9363-9392 [PMID:22931505]
DNA polymerase beta in Human (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL2392] [GtoPdb: 3231] [UniProtKB: P06746]
ChEMBL	Inhibition of human DNA polymerase beta	B	4.3	pIC50	>50000	nM	IC50	J Med Chem (2008) 51: 5843-5855 [PMID:18763751]
Kv11.1/HERG in Human (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL240] [GtoPdb: 572] [UniProtKB: Q12809]
ChEMBL	Binding affinity to human ERG	B	4.3	pIC50	>50000	nM	IC50	J Med Chem (2008) 51: 5843-5855 [PMID:18763751]
Human immunodeficiency virus type 1 integrase in Human immunodeficiency virus 1 (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL3471] [UniProtKB: Q7ZJM1]
ChEMBL	Inhibition of subunit exchanging activity of His and Flag-tagged HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells after 2.5 hrs by HTRF assay	B	4	pIC50	>100000	nM	IC50	Eur J Med Chem (2019) 182: 111617-111617 [PMID:31442684]
ChEMBL	Inhibition of HIV1 integrase 3'-processing activity by gel-based assays	B	4.89	pIC50	12800	nM	IC50	J Med Chem (2014) 57: 3223-3234 [PMID:24684270]
ChEMBL	Inhibition of HIV-1 integrase assessed as inhibition of 3'-processing activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in presence of Mg2+	B	4.89	pIC50	12800	nM	IC50	J Med Chem (2015) 58: 4610-4623 [PMID:25961960]
ChEMBL	Inhibition of HIV1 recombinant integrase 3'-processing activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor magnesium	B	5.35	pIC50	>4500	nM	IC50	Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL	Inhibition of HIV1 recombinant integrase 3'-processing activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor manganese	B	5.35	pIC50	>4500	nM	IC50	Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL	Inhibition of HIV-1 integrase after 1 hr by strand transfer activity assay	B	5.74	pIC50	1800	nM	IC50	Bioorg Med Chem (2015) 23: 735-741 [PMID:25618597]
ChEMBL	Inhibition of recombinant HIV1 integrase strand transfer activity using biotin-labeled double-stranded HIV1 LTR U5 donor DNA substrate pretreated for 5 mins followed by substrate addition and measured after 30 mins by ELISA	B	5.96	pIC50	1100	nM	IC50	Bioorg Med Chem (2019) 27: 3595-3604 [PMID:31285097]
ChEMBL	Inhibition of Human immunodeficiency virus 1 integrase-mediated strand transfer activity after 1 hr	B	6.05	pIC50	900	nM	IC50	Bioorg Med Chem (2012) 20: 177-182 [PMID:22154762]
ChEMBL	Inhibition of 3'-processing activity of HIV1 integrase using 32P-5'-TGTGGAAAATCTCTAGCAGT-3' and 5'-ACTGCTAGAGATTTTCCACA-3' as substrate after 1 hr by ELISA	B	6.05	pIC50	900	nM	IC50	ACS Med Chem Lett (2013) 4: 606-611 [PMID:24900718]
ChEMBL	Inhibition of HIV1 integrase 3'-end processing activity	B	6.05	pIC50	900	nM	IC50	J Med Chem (2008) 51: 7717-7730 [PMID:19053754]
ChEMBL	Inhibition of HIV integrase strand transfer activity using 5'-biotin/3'-Cy5-labeled DNA substrate preincubated for 5 mins followed by substrate addition measured after 30 mins by HTS assay	B	6.19	pIC50	650	nM	IC50	Eur J Med Chem (2018) 156: 652-665 [PMID:30031976]
ChEMBL	Inhibition of HIV1 integrase strand transfer activity using 5'-biotinylated oligonucleotide as substrate preincubated for 10 mins followed by substrate addition and measured after 30 mins	B	6.19	pIC50	650	nM	IC50	Eur J Med Chem (2019) 166: 390-399 [PMID:30739822]
ChEMBL	Inhibition of HIV1 recombinant integrase expressed in Escherichia coli using [32P]-labeled oligonucleotide as substrate after 60 mins by strand transfer activity assay	B	6.19	pIC50	650	nM	IC50	J Med Chem (2016) 59: 6136-6148 [PMID:27283261]
ChEMBL	Inhibition of HIV1 integrase pre-incubated for 10 mins before DNA substrate addition and measured after 30 mins	B	6.19	pIC50	650	nM	IC50	Eur J Med Chem (2017) 141: 149-161 [PMID:29031062]
ChEMBL	Inhibition of recombinant HIV1 integrase strand transfer activity using biotin-labeled double-stranded HIV-1 LTR U5 donor DNA substrate pretreated for 5 mins followed by substrate addition and measured after 30 mins by ELISA	B	6.7	pIC50	200	nM	IC50	Eur J Med Chem (2018) 155: 714-724 [PMID:29940462]
ChEMBL	Inhibition of HIV1 integrase	B	6.92	pIC50	120	nM	IC50	Bioorg Med Chem Lett (2014) 24: 302-307 [PMID:24291042]
ChEMBL	Inhibition of HIV-1 integrase assessed as inhibition of strand transfer activity using 32P-labeled DNA as substrate after 1 hr by gel-based assay in presence of Mg2+	B	7.06	pIC50	87	nM	IC50	J Med Chem (2015) 58: 4610-4623 [PMID:25961960]
ChEMBL	Inhibition of HIV1 integrase strand transfer activity by gel-based assay	B	7.06	pIC50	87	nM	IC50	J Med Chem (2014) 57: 3223-3234 [PMID:24684270]
ChEMBL	Inhibition of HIV1 integrase using labelled oligonucleotide substrate by ELISA	B	7.1	pIC50	80	nM	IC50	Bioorg Med Chem Lett (2009) 19: 3615-3618 [PMID:19447621]
ChEMBL	Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor manganese	B	7.13	pIC50	74	nM	IC50	Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL	Inhibition of strand transfer activity of HIV1 integrase expressed in Escherichia coli using DNA complexes containing 32P-labeled INT1ST and and non-labeled INT2	B	7.15	pIC50	71	nM	IC50	Bioorg Med Chem (2019) 27: 3836-3845 [PMID:31324562]
ChEMBL	Inhibition of HIV1 integrase 3'-processing activity using labelled oligonucleotide substrate by ELISA	B	7.17	pIC50	67	nM	IC50	Bioorg Med Chem Lett (2009) 19: 3615-3618 [PMID:19447621]
ChEMBL	Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 60 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis in presence of cofactor magnesium	B	7.17	pIC50	67	nM	IC50	Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL	Inhibition of HIV1 recombinant integrase strand transfer activity expressed in Escherichia coli after 30 mins using [32P]-labeled oligonucleotide as a substrate by densitometric analysis	B	7.17	pIC50	67	nM	IC50	Bioorg Med Chem Lett (2011) 21: 2986-2990 [PMID:21493066]
ChEMBL	Inhibition of LEDGF/p75-dependent full length HIV-1 integrase expressed in Escherichia coli BL21(DE3) cells preincubated for 1 hr further incubated for 90 mins with biotin-labeled donor DNA and target DNA by HTRF assay	B	7.24	pIC50	58	nM	IC50	Eur J Med Chem (2019) 182: 111617-111617 [PMID:31442684]
ChEMBL	Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'-CGACGCGTGGTAGGCCTGT-Biotin3'/5'-Cy5-ATGTGGAAAATCTCTAGCAGT-3' annealed with 5'-Cy5-TGAGCTCGAGATTTTCCACAT-3' as donar/acceptor DNA substrate preincubated for 1 hr followed by DNA and LEDGF/p75 addition measured after 90 mins by HTRF assay	B	7.28	pIC50	53	nM	IC50	Bioorg Med Chem Lett (2015) 25: 3013-3016 [PMID:26048795]
ChEMBL	Inhibition of HIV-1 integrase G140S mutant strand transfer activity preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by microplate reader analysis	B	7.3	pIC50	50	nM	IC50	ACS Med Chem Lett (2015) 6: 1065-1070 [PMID:26487913]
ChEMBL	Inhibition of HIV1 integrase strand transfer activity	B	7.47	pIC50	34	nM	IC50	Antimicrob Agents Chemother (2009) 53: 1194-1203 [PMID:19104010]
ChEMBL	Inhibition of wild type recombinant HIV1 His6-tagged integrase expressed in Escherichia coli BL21 using 18 nucleotide 3'-biotin labeled DNA acceptor as substrate preincubated for 1 hr followed by substrate addition and further incubated for 90 mins in presence of recombinant LEDGF/p75 by HTRF assay	B	7.57	pIC50	27	nM	IC50	ACS Med Chem Lett (2020) 11: 766-772 [PMID:32435383]
ChEMBL	Inhibition of recombinant His-tagged HIV-1 NL4-3 integrase expressed in Escherichia coli BL21 pLys using GTGTGGAAAATCTCTAGCA/ACTGCTAGAGATTTTCCACAC as DNA substrate incubated for 2 hrs by densitometric analysis	B	7.72	pIC50	19	nM	IC50	J Med Chem (2021) 64: 8579-8598 [PMID:34106711]
ChEMBL	Displacement of 20 nM [3H]GSK304649 from Human immunodeficiency virus 1 integrase by scintillation proximity assay	B	7.8	pIC50	16	nM	IC50	Antimicrob Agents Chemother (2008) 52: 901-908 [PMID:18160521]
ChEMBL	Inhibition of HIV-1 integrase G140S/Q148K double mutant	B	7.82	pIC50	15	nM	IC50	J Med Chem (2023) 66: 13874-13887 [PMID:37827528]
ChEMBL	Inhibition of recombinant HIV-1 integrase strand transfer activity	B	7.82	pIC50	15	nM	IC50	Bioorg Med Chem Lett (2009) 19: 4617-4621 [PMID:19616948]
ChEMBL	Inhibition of HIV1 recombinant integrase strand transfer activity	B	7.82	pIC50	15	nM	IC50	J Med Chem (2008) 51: 5843-5855 [PMID:18763751]
ChEMBL	Inhibition of recombinant HIV-1 integrase strand transfer activity by enzymatic assay	B	7.82	pIC50	15	nM	IC50	J Med Chem (2022) 65: 5830-5849 [PMID:35377638]
ChEMBL	Inhibition of HIV-1 integrase strand transfer activity	B	7.82	pIC50	15	nM	IC50	J Med Chem (2023) 66: 13874-13887 [PMID:37827528]
ChEMBL	Inhibition of recombinant HIV-1 integrase stand transfer activity expressed in Escherichia coli BL21(DE3) cells using 32P-labeled DNA substrate after 1 hr by densitometric analysis	B	7.89	pIC50	13	nM	IC50	Eur J Med Chem (2015) 104: 127-138 [PMID:26451771]
ChEMBL	Inhibition of HIV1 integrase overall inhibition using 5'-digoxigenin-labeled 5'-GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT-3' as substrate after 1 hr by ELISA	B	8	pIC50	10	nM	IC50	ACS Med Chem Lett (2013) 4: 606-611 [PMID:24900718]
ChEMBL	Inhibition of HIV-1 overall integrase activity using 5'-digoxigenin-labeled GACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT-3' as substrate after 1 hr by ELISA	B	8	pIC50	10	nM	IC50	J Med Chem (2014) 57: 4640-4660 [PMID:24793360]
ChEMBL	Inhibition of HIV-1 integrase after 1 hr by ELISA	B	8.05	pIC50	9	nM	IC50	Eur J Med Chem (2011) 46: 756-764 [PMID:21227550]
ChEMBL	Inhibition of HIV1 integrase	B	8.05	pIC50	9	nM	IC50	Bioorg Med Chem (2010) 18: 5510-5518 [PMID:20630765]
ChEMBL	Inhibition of Human immunodeficiency virus 1 integrase	B	8.05	pIC50	9	nM	IC50	Antimicrob Agents Chemother (2008) 52: 2861-2869 [PMID:18541726]
ChEMBL	Inhibition of HIV1 integrase	B	8.05	pIC50	9	nM	IC50	J Med Chem (2008) 51: 7717-7730 [PMID:19053754]
ChEMBL	Inhibition of HIV1 integrase	B	8.05	pIC50	9	nM	IC50	Bioorg Med Chem Lett (2008) 18: 2891-2895 [PMID:18417342]
ChEMBL	Inhibition of HIV1 integrase strand transfer	B	8.15	pIC50	7	nM	IC50	Bioorg Med Chem (2010) 18: 5510-5518 [PMID:20630765]
ChEMBL	Inhibition of HIV-1 integrase strand transfer activity preincubated for 30 mins followed by addition of FITC-labelled dsDNA for 1 hr by microplate reader analysis	B	8.15	pIC50	7	nM	IC50	ACS Med Chem Lett (2015) 6: 1065-1070 [PMID:26487913]
ChEMBL	Inhibition of strand transfer activity of recombinant HIV1 integrase using 5'-end-labeled 21-mer double-stranded DNA as substrate after 60 mins by electrochemiluminescent plate-based assay	B	8.15	pIC50	7	nM	IC50	J Med Chem (2013) 56: 8588-8598 [PMID:24124919]
ChEMBL	Inhibition of HIV1 integrase strand transfer activity	B	8.15	pIC50	7	nM	IC50	J Med Chem (2008) 51: 7717-7730 [PMID:19053754]
ChEMBL	Inhibition of HIV1 integrase strand transfer activity	B	8.15	pIC50	7	nM	IC50	Bioorg Med Chem Lett (2008) 18: 2891-2895 [PMID:18417342]
ChEMBL	Inhibition of strand transfer activity of HIV1 integrase using pre-cleaved oligonucleotide as substrate after 1 hr by ELISA	B	8.15	pIC50	7	nM	IC50	ACS Med Chem Lett (2013) 4: 606-611 [PMID:24900718]
ChEMBL	Inhibition of HIV-1 integrase strand transfer activity by gel-based assay	B	8.15	pIC50	7	nM	IC50	J Med Chem (2015) 58: 1915-1928 [PMID:25629256]
ChEMBL	Inhibition of Human immunodeficiency virus 1 integrase strand transfer activity	B	8.17	pIC50	6.8	nM	IC50	Antimicrob Agents Chemother (2008) 52: 2861-2869 [PMID:18541726]
ChEMBL	Inhibition of HIV1 recombinant integrase 3'-processing and strand transfer activity using 21-mer U5B/U5A duplex oligonucleotides after 1 hr	B	8.3	pIC50	5	nM	IC50	Bioorg Med Chem (2011) 19: 5000-5005 [PMID:21767953]
ChEMBL	Inhibition of Human immunodeficiency virus 1 integrase by strand transfer scintillation proximity assay	B	8.48	pIC50	3.3	nM	IC50	Antimicrob Agents Chemother (2008) 52: 901-908 [PMID:18160521]
ChEMBL	Inhibition of His-tagged HIV-1 integrase-mediated 3' processing and strand transfer reactions using 5'-ACAGGCCTAGCACGCGTCG-Biotin-3' annealed with 5'-CGACGCGTGGTAGGCCTGT-Biotin3'/5'-Cy5-ATGTGGAAAATCTCTAGCAGT-3' annealed with 5'-Cy5-TGAGCTCGAGATTTTCCACAT-3' as donar/acceptor DNA substrate preincubated for 1 hr followed by DNA and LEDGF/p75 addition measured after 90 mins by HTRF assay in presence of 300 mM sucrose	B	8.62	pIC50	2.4	nM	IC50	Bioorg Med Chem Lett (2015) 25: 3013-3016 [PMID:26048795]
ChEMBL	Inhibition of HIV integrase strand transfer activity	B	8.7	pIC50	2	nM	IC50	Bioorg Med Chem (2019) 27: 3836-3845 [PMID:31324562]
Human immunodeficiency virus type 1 reverse transcriptase in Human immunodeficiency virus 1 (target type: SINGLE PROTEIN) [ChEMBL: CHEMBL247] [UniProtKB: Q72547]
ChEMBL	Inhibition of HIV1 RNase H function of recombinant reverse transcriptase using an 18-nt 3'-fluorescein-labeled RNA annealed to complementary 18-nt 5'-dabsyl-labeled DNA as substrate after 10 mins by fluorescence spectrometer analysis	B	4	pIC50	>100000	nM	IC50	J Med Chem (2014) 57: 3223-3234 [PMID:24684270]
ChEMBL	Inhibition of RNase H function of HIV1 reverse transcriptase using DNA/RNA hybrid as substrate by fluorescence spectrometer analysis	B	4	pIC50	>100000	nM	IC50	J Med Chem (2015) 58: 4610-4623 [PMID:25961960]
ChEMBL	Inhibition of RNH activity of recombinant HIV1 reverse transcriptase RNase H assessed as reduction in internal cleavage of RNA strand using RNA/DNA duplex substrate HTS-1	B	5	pIC50	>10000	nM	IC50	Eur J Med Chem (2017) 141: 149-161 [PMID:29031062]
ChEMBL	Inhibition of HIV1 reverse transcriptase RNaseH activity using 3'-fluorescein/5'-Dabcyl labeled HTS-1 substrate	B	5	pIC50	>10000	nM	IC50	Eur J Med Chem (2018) 156: 652-665 [PMID:30031976]
ChEMBL	Inhibition of HIV1 reverse transcriptase RNase H expressed in Escherichia coli JM109 using RNA/DNA duplex substrate HTS-1	B	5	pIC50	>10000	nM	IC50	Eur J Med Chem (2019) 166: 390-399 [PMID:30739822]
ChEMBL	Inhibition of RNase H activity of full length HIV1 reverse transcriptase using RNA-DNA duplex HTS-1 substrate	B	5	pIC50	>10000	nM	IC50	J Med Chem (2016) 59: 6136-6148 [PMID:27283261]
Kv7.1/Voltage-gated potassium channel, IKs; KCNQ1(Kv7.1)/KCNE1(MinK) in Human (target type: PROTEIN COMPLEX) [ChEMBL: CHEMBL2221347] [GtoPdb: 560] [UniProtKB: P15382, P51787]
ChEMBL	Inhibition of slow delayed inward rectifying potassium current (Iks) in Chinese Hamster Ovary (CHO) cells expressing hKvLQT1/hminK measured using IonWorks Quattro automated patch clamp platform	F	4.6	pIC50	25118.86	nM	IC50	J Pharmacol Toxicol Methods (2014) 70: 246-254 [PMID:25087753]

ChEMBL data shown on this page come from version 34:

Zdrazil B, Felix E, Hunter F, Manners EJ, Blackshaw J, Corbett S, de Veij M, Ioannidis H, Lopez DM, Mosquera JF, Magarinos MP, Bosc N, Arcila R, Kizilören T, Gaulton A, Bento AP, Adasme MF, Monecke P, Landrum GA, Leach AR. (2024). The ChEMBL Database in 2023: a drug discovery platform spanning multiple bioactivity data types and time periods. Nucleic Acids Res., 52(D1). DOI: 10.1093/nar/gkad1004. [EPMCID:10767899] [PMID:37933841]
Davies M, Nowotka M, Papadatos G, Dedman N, Gaulton A, Atkinson F, Bellis L, Overington JP. (2015) 'ChEMBL web services: streamlining access to drug discovery data and utilities.' Nucleic Acids Res., 43(W1). DOI: 10.1093/nar/gkv352. [EPMCID:25883136]