viltolarsen   Click here for help

GtoPdb Ligand ID: 11430

Synonyms: NCNP-01 | NS-065 | Viltepso®
Approved drug
viltolarsen is an approved drug (FDA (2020))
Compound class: Synthetic organic
Comment: Viltolarsen is an antisense phosphorodiamidate morpholino oligomer (PMO) class nucleotide drug. Its abbreviated chemical/nucleotide structure is all-P-ambo-[2',3'-azanediyl-P,2',3'-trideoxy-P-(dimethylamino)-2',3'-seco](2'-N→5')(CCTCCGGTTCTGAAGGTGTTC). Viltolarsen restores the reading frame of certain dystrophin gene mutations and promotes synthesis of a shorter but functional dystrophin protein.
2D Structure
Click here for help
Click here for structure editor
Physico-chemical Properties
Click here for help
Hydrogen bond acceptors 141
Hydrogen bond donors 29
Rotatable bonds 122
Topological polar surface area 2504.15
Molecular weight 6921.36
XLogP -21.82
No. Lipinski's rules broken 3
SMILES / InChI / InChIKey
Click here for help
Canonical SMILES OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1ccc(nc1=O)N)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@@H]1CNC[C@@H](O1)n1ccc(nc1=O)N)n1cc(C)c(=O)[nH]c1=O)n1cc(C)c(=O)[nH]c1=O)n1cnc2c1nc(N)[nH]c2=O)n1cc(C)c(=O)[nH]c1=O)n1cnc2c1nc(N)[nH]c2=O)n1cnc2c1nc(N)[nH]c2=O)n1cnc2c1ncnc2N)n1cnc2c1ncnc2N)n1cnc2c1nc(N)[nH]c2=O)n1cc(C)c(=O)[nH]c1=O)n1cc(C)c(=O)[nH]c1=O)n1cc(C)c(=O)[nH]c1=O)n1cnc2c1nc(N)[nH]c2=O)n1cnc2c1nc(N)[nH]c2=O)n1ccc(nc1=O)N)n1ccc(nc1=O)N)n1cc(C)c(=O)[nH]c1=O)n1ccc(nc1=O)N)n1ccc(nc1=O)N
Isomeric SMILES OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1ccc(nc1=O)N)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@H]1O[C@H](CN(C1)P(=O)(N(C)C)OC[C@@H]1CNC[C@@H](O1)n1ccc(nc1=O)N)n1cc(C)c(=O)[nH]c1=O)n1cc(C)c(=O)[nH]c1=O)n1cnc2c1nc(N)[nH]c2=O)n1cc(C)c(=O)[nH]c1=O)n1cnc2c1nc(N)[nH]c2=O)n1cnc2c1nc(N)[nH]c2=O)n1cnc2c1ncnc2N)n1cnc2c1ncnc2N)n1cnc2c1nc(N)[nH]c2=O)n1cc(C)c(=O)[nH]c1=O)n1cc(C)c(=O)[nH]c1=O)n1cc(C)c(=O)[nH]c1=O)n1cnc2c1nc(N)[nH]c2=O)n1cnc2c1nc(N)[nH]c2=O)n1ccc(nc1=O)N)n1ccc(nc1=O)N)n1cc(C)c(=O)[nH]c1=O)n1ccc(nc1=O)N)n1ccc(nc1=O)N
InChI Key ZVXLKCOOOKREJD-OERAVCCFSA-N
Classification Click here for help
Compound class Synthetic organic
Approved drug? Yes (FDA (2020))
International Nonproprietary Names Click here for help
INN number INN
10771 viltolarsen
Synonyms Click here for help
NCNP-01 | NS-065 | Viltepso®
Database Links Click here for help
GtoPdb PubChem SID 440816799
PubChem CID 154562176
Search Google for chemical match using the InChIKey ZVXLKCOOOKREJD-OERAVCCFSA-N
Search Google for chemicals with the same backbone ZVXLKCOOOKREJD
Search PubMed clinical trials viltolarsen
Search PubMed titles viltolarsen
Search PubMed titles/abstracts viltolarsen
Search UniChem for chemical match using the InChIKey ZVXLKCOOOKREJD-OERAVCCFSA-N
Search UniChem for chemicals with the same backbone ZVXLKCOOOKREJD